si:ch211-103f16.5

Ensembl ID:
ENSDARG00000093600
ZFIN ID:
ZDB-GENE-060503-756
Description:
Novel protein similar to vertebrate osteomodulin (OMD) [Source:UniProtKB/TrEMBL;Acc:Q1LV49]
Human Orthologue:
OMD
Human Description:
osteomodulin [Source:HGNC Symbol;Acc:8134]
Mouse Orthologue:
Omd
Mouse Description:
osteomodulin Gene [Source:MGI Symbol;Acc:MGI:1350918]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43777 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143352 Nonsense 272 399 1 2
Genomic Location (Zv9):
Chromosome 22 (position 10577272)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 10437440
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAGAAGACTCCCAATCTCGTGTCCCTGAGAATGCCGCACAATAAACTC[A/T]AGTCTGTTGCATACAATGCCTTTAATCTGTCCAAGCTAATGGAGCTCCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link