NRP1 (2 of 3)

Ensembl ID:
ENSDARG00000093598
Description:
neuropilin 1 [Source:HGNC Symbol;Acc:8004]
Human Orthologue:
NRP1
Human Description:
neuropilin 1 [Source:HGNC Symbol;Acc:8004]
Mouse Orthologue:
Nrp1
Mouse Description:
neuropilin 1 Gene [Source:MGI Symbol;Acc:MGI:106206]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32 Missense Confirmed mutation in F2 line During 2017
sa24430 Nonsense Available for shipment Available now
sa1485 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106642 Missense 5 190 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1261448)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1252764
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGATGAATGTGTGTTCATGTGTGTGTTTCTCTCTCTGCAGATATGAC[T/A]ATGTGGAAGTGAGAGACGGCGTGGATGAGAACGGGCAGCTGGTGGGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106642 Nonsense 46 190 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1261323)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1252639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGTGGTCTCGTCGGGAAACCAGCTCTTCATCAAGTTTGTGTCCGACTA[C/A]GAGACTCACGGTGCCGGATTCTCCATCCGCTATGAGATCTTCAAAACGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1485
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106642 Nonsense 127 190 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 1248914)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 1240230
KASP Assay ID:
554-1410.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGAGCTGGAGCCAGACACGCAGCCGCCCGCCGGAGTCTTCTGCCGATA[C/A]GACCGCCTGGAGATTTGGGACGGATTCCCTGGAGGTGAGTCAATGGAGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link