si:dkey-14d8.20

Ensembl ID:
ENSDARG00000093586
ZFIN ID:
ZDB-GENE-041210-146
Description:
Novel protein similar to vertebrate scavenger receptor protein [Source:UniProtKB/TrEMBL;Acc:Q5RHW7]
Human Orthologues:
AC008735.1, CD5L
Human Descriptions:
CD5 molecule-like [Source:HGNC Symbol;Acc:1690]
Scavenger receptor cysteine-rich domain-containing protein LOC284297 [Source:UniProtKB/Swiss-Prot;Ac
Mouse Orthologues:
A430110N23Rik, Cd5l
Mouse Descriptions:
CD5 antigen-like Gene [Source:MGI Symbol;Acc:MGI:1334419]
RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6047 Nonsense Mutation detected in F1 DNA During 2017
sa13640 Nonsense Available for shipment Available now
sa14156 Nonsense Available for shipment Available now
sa13941 Nonsense Available for shipment Available now
sa15797 Nonsense Available for shipment Available now
sa10315 Essential Splice Site Available for shipment Available now
sa33373 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6047
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 525 1140 5 11
Genomic Location (Zv9):
Chromosome 4 (position 5271685)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5389866
KASP Assay ID:
554-3721.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTTAAGCCGAAAASTACTGACCATTCGAAGGACGCTGGGGTCATCTG[C/A]GACTGTAAGTCWTTTATATTTTATGCAAGTAAAAAGAGAAATGAAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 538 1140 6 11
ENSDART00000135122 Nonsense 538 1140 6 11
Genomic Location (Zv9):
Chromosome 4 (position 5272197)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5390378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAATGTGGATTCAGCTCCTGTCAGGCTCATTAATGGAAATAACTCGTG[T/A]TCTGGAYGAGYGGAGGTTTTCTATAGTGGTCAGTGGGGAACAGTGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14156
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 538 1140 6 11
ENSDART00000135122 Nonsense 538 1140 6 11
Genomic Location (Zv9):
Chromosome 4 (position 5272197)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5390378
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTAATGTGGATTCAGCTCCTGTCAGGCTCATTAATGGAAATAACTCGTG[T/A]TCTGGAYGAGYGGAGGTTTTCTATAGTGGTCAGTGGGGAACAGTGTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13941
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 541 1140 6 11
Genomic Location (Zv9):
Chromosome 4 (position 5272204)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5390385
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGATTCAGCTCCTGTCAGGCTCATTAATGGAAATAACTCGTGWTCTGGA[C/T]GAGYGGAGGTTTTCTATAGTGGTCAGTGGGGAACAGTGTGTGGTGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15797
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 855 1140 9 11
Genomic Location (Zv9):
Chromosome 4 (position 5283418)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5401599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGGCATCAACTCTTGTTCTGGACGAGTGGAGGTTTTCCATAACGGCT[T/G]ATGGGGAACAGTGTGTGATGATTACTGGGGTCTGACAAACGCTGCAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Essential Splice Site 1039 1140 11 11
Genomic Location (Zv9):
Chromosome 4 (position 5288456)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5406637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTGTTAATCTCAGTTTTTTGTCTTTGTTTTTTCATTGGTGTCATCATCA[G/A]TCCCTGTCAGGCTGAYGGGTGGAMGAGACGCATGTTCTGGACTTGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33373
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135122 Nonsense 1123 1140 11 11
Genomic Location (Zv9):
Chromosome 4 (position 5288708)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 5406889
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGTCGACTGTGTTGGCAGTGAGTCTTCCCTAATACAATGTAGCTTAGAT[C/T]GATGGCTGCCAAATCACGTCAACCATCTGAATGATGCTGGAGTCGTCTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link