si:dkey-20i20.7

Ensembl ID:
ENSDARG00000093562
ZFIN IDs:
ZDB-GENE-060503-906, ZDB-GENE-071004-118
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPU6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37404 Nonsense Available for shipment Available now
sa11217 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132419 Nonsense 224 300 3 4
Genomic Location (Zv9):
Chromosome 22 (position 2048064)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2789154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGAAGAGAAACCGTATCACTGCACTGCTTGTTGGAAGAGATTCTCATA[T/G]TCATCTTCTCTACGACAACACTCACTAAACTGTCAGAGTAAGTAGATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11217
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132419 Nonsense 255 300 4 4
Genomic Location (Zv9):
Chromosome 22 (position 2049305)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2790395
KASP Assay ID:
2261-6253.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGGTGAAGGAGGAGAGKGAAAAACTGAATGAAGATGARGAGAAACAT[C/T]AAGAAAAAMCCCAATCAGAGACTGAAAGTATTTCAGTGAAAGGAACAGCW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link