myo5b

Ensembl ID:
ENSDARG00000093553
ZFIN ID:
ZDB-GENE-031219-7
Description:
Novel protein similar to vertebrate myosin V family (Myo5) [Source:UniProtKB/TrEMBL;Acc:Q1LWT8]
Human Orthologue:
MYO5B
Human Description:
myosin VB [Source:HGNC Symbol;Acc:7603]
Mouse Orthologue:
Myo5b
Mouse Description:
myosin VB Gene [Source:MGI Symbol;Acc:MGI:106598]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3127 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa3127
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135062 None None 502 None 13
ENSDART00000141076 Nonsense 92 249 2 5
ENSDART00000142707 Nonsense 1290 1525 29 34
ENSDART00000144461 None None 158 None 4
Genomic Location:
Chromosome 21 (position 21517222)
KASP Assay ID:
554-3228.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATTTCATCTGCACAGAATTCCAACGATGTGTCTGAGTGGACCGACAAC[A/T]AGAGCCCTGTGGACRCRGAGGACCGCGTGGATGCGCCTGCATCAAAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m0h475ut