ms4a17a.2

Ensembl ID:
ENSDARG00000093546
ZFIN ID:
ZDB-GENE-070705-367
Description:
hypothetical protein LOC798290 [Source:RefSeq peptide;Acc:NP_001093531]
Human Orthologues:
MS4A12, MS4A15, MS4A2, MS4A3, MS4A4A, MS4A8B, RP11-312N17.2
Human Descriptions:
Membrane-spanning 4-domains subfamily A member 18 [Source:UniProtKB/Swiss-Prot;Acc:Q3C1V0]
membrane-spanning 4-domains, subfamily A, member 12 [Source:HGNC Symbol;Acc:13370]
membrane-spanning 4-domains, subfamily A, member 15 [Source:HGNC Symbol;Acc:28573]
membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor fo
membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific) [Source:HGNC Symbol
membrane-spanning 4-domains, subfamily A, member 4 [Source:HGNC Symbol;Acc:13371]
membrane-spanning 4-domains, subfamily A, member 8B [Source:HGNC Symbol;Acc:13380]
Mouse Orthologues:
AC134839.1, Ms4a15, Ms4a2, Ms4a3, Ms4a4b, Ms4a4c, Ms4a4d, Ms4a8a
Mouse Descriptions:
membrane-spanning 4-domains, subfamily A, member 15 Gene [Source:MGI Symbol;Acc:MGI:3617853]
membrane-spanning 4-domains, subfamily A, member 2 Gene [Source:MGI Symbol;Acc:MGI:95495]
membrane-spanning 4-domains, subfamily A, member 3 Gene [Source:MGI Symbol;Acc:MGI:2158468]
membrane-spanning 4-domains, subfamily A, member 4B Gene [Source:MGI Symbol;Acc:MGI:1913083]
membrane-spanning 4-domains, subfamily A, member 4C Gene [Source:MGI Symbol;Acc:MGI:1927656]
membrane-spanning 4-domains, subfamily A, member 4D Gene [Source:MGI Symbol;Acc:MGI:1913857]
membrane-spanning 4-domains, subfamily A, member 8A Gene [Source:MGI Symbol;Acc:MGI:1927657]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31408 Essential Splice Site Available for shipment Available now
sa33512 Nonsense Mutation detected in F1 DNA During 2016
sa14285 Essential Splice Site Available for shipment Available now
sa20315 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31408
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005585 Essential Splice Site 58 247 2 7

The following transcripts of ENSDARG00000093546 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 60717485)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75098610
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTCAAGGAATTCAGGCCTTTCTTAAAGGCCAACCGAAAGCCCTCGGGG[T/C]GAGAAATCTCCCTTAAACCCAGATAACACACATTAACACACAGCATGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005585 Nonsense 158 247 5 7

The following transcripts of ENSDARG00000093546 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 60719978)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75101103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGGTTTGGCTGTTGGACCCACCAACCGTTACTGCAGAGACTTTTATTG[T/A]TATAATTATACGGTAAGTCATCAACTCTTAAATTTATATCATTTTTGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005585 Essential Splice Site 162 247 5 7

The following transcripts of ENSDARG00000093546 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 60719992)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75101117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGACCCACCAACCGTTACTGCAGAGACTTTTATTGTTATAATTATACGG[T/A]AAGTCATCAACTCTTAAATTKATAKCATTTTTGTATTRTKTTATTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20315
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005585 Nonsense 243 247 7 7

The following transcripts of ENSDARG00000093546 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 60730983)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 75112108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCCTGAACCATGCTTTCAACATCCTCCTGCAGAAACTCCCCCAGCGTA[C/A]ACTGAAGGCAAATAAATGTGAATCAACATGAAAAACGGGGCAGAGCGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link