si:ch211-255f4.12

Ensembl ID:
ENSDARG00000093510
ZFIN ID:
ZDB-GENE-050208-468
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MSY9]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6691 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136178 Essential Splice Site 17 48 2 2
Genomic Location (Zv9):
Chromosome 22 (position 2780941)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1593789
KASP Assay ID:
554-4535.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAATTRATCAGATTTCTCTGTTTATTCCTCTAAAGMTCTGCCGYCATCA[G/T]TGAAAGACAAAGACAGAGTTTATTGAAGGACAGTGAGAAGATGAGTGATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link