si:dkey-21n12.1

Ensembl ID:
ENSDARG00000093503
ZFIN ID:
ZDB-GENE-030131-5829
Description:
Si:dkey-21n12.1 protein [Source:UniProtKB/TrEMBL;Acc:Q7SXJ8]
Human Orthologue:
RSF1
Human Description:
remodeling and spacing factor 1 [Source:HGNC Symbol;Acc:18118]
Mouse Orthologue:
Rsf1
Mouse Description:
remodeling and spacing factor 1 Gene [Source:MGI Symbol;Acc:MGI:2682305]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34954 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34954
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137688 Essential Splice Site 182 542 4 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 37875617)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36687778
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAAGAGCAGGATGATTTGGATGGGTCGTCCTGGAAATGTATAGTAAG[G/A]TAGGCATTCTGCATTTAATTTTTGTCCTCTTATTATGCCTTTTTGAAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link