CYP46A1 (5 of 5)

Ensembl ID:
ENSDARG00000093477
Description:
cytochrome P450, family 46, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2641]
Human Orthologue:
CYP46A1
Human Description:
cytochrome P450, family 46, subfamily A, polypeptide 1 [Source:HGNC Symbol;Acc:2641]
Mouse Orthologue:
Cyp46a1
Mouse Description:
cytochrome P450, family 46, subfamily a, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:1341877]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36957 Essential Splice Site Mutation detected in F1 DNA During 2017
sa44932 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138064 Essential Splice Site 139 485 4 16
Genomic Location (Zv9):
Chromosome 20 (position 5175435)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 5091028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAAGATCCATTTGTCTACCGACGCGTCTTTAACTTGTTTGGGAAAAG[G/A]TAAACTTTAATTTGTTCTTAAATGATCACATCTCTACATCGATTTAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138064 Nonsense 343 485 12 16
Genomic Location (Zv9):
Chromosome 20 (position 5179386)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGATGAAGTCCTCGGAACCAAAAGGGAAATTTCAAATGAAGACCTT[G/T]GAAAATTGACTTACTTGTCTCAGGTTGGTTCATAGAGACTTTTACATGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link