si:ch211-175l6.1

Ensembl ID:
ENSDARG00000093464
ZFIN ID:
ZDB-GENE-060503-861
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1MT13]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11620 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146637 Nonsense 149 319 4 5
Genomic Location (Zv9):
Chromosome 3 (position 8079409)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8126193
KASP Assay ID:
2259-3046.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTCATGTGTGKCGCTACTTGGGGAACCTGCCGTTCAGAGTCTGGAAG[A/T]AGATGCAGGACATCGTCCACTACAGTAAGAGTCCCTACAACATCTCTACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link