tnfaip6

Ensembl ID:
ENSDARG00000093440
ZFIN ID:
ZDB-GENE-060421-2654
Description:
tumor necrosis factor-inducible gene 6 protein [Source:RefSeq peptide;Acc:NP_001035333]
Human Orthologues:
STAB1, STAB2, TNFAIP6
Human Descriptions:
stabilin 1 [Source:HGNC Symbol;Acc:18628]
stabilin 2 [Source:HGNC Symbol;Acc:18629]
tumor necrosis factor, alpha-induced protein 6 [Source:HGNC Symbol;Acc:11898]
Mouse Orthologues:
Stab1, Stab2, Tnfaip6
Mouse Descriptions:
stabilin 1 Gene [Source:MGI Symbol;Acc:MGI:2178742]
stabilin 2 Gene [Source:MGI Symbol;Acc:MGI:2178743]
tumor necrosis factor alpha induced protein 6 Gene [Source:MGI Symbol;Acc:MGI:1195266]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5536 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000090875 Essential Splice Site 88 271 2 6
Genomic Location:
Chromosome 9 (position 23801677)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGGCACTCTTGCTACGTTTGATCAACTGGAAGCTGCTCGCCAAATTGG[T/G]TTGTATCGCACTTACAAATCACACTTAGATCAGATGCCAAAAGAAACAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)
  • Coronary restenosis: A genome-wide association study identifies a region at chromosome 12 as a potential susceptibility locus for restenosis after percutaneous coronary intervention. (View Study)
  • Lung cancer: Genome-wide association analysis identifies new lung cancer susceptibility loci in never-smoking women in Asia. (View Study)
  • vWF and FVIII levels: Combined analysis of three genome-wide association studies on vWF and FVIII plasma levels. (View Study)
  • Waist-hip ratio: Meta-analysis identifies 13 new loci associated with waist-hip ratio and reveals sexual dimorphism in the genetic basis of fat distribution. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a1x53x6g