si:ch211-9n13.3

Ensembl ID:
ENSDARG00000093432
ZFIN ID:
ZDB-GENE-060503-800
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LVP3]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3028 Essential Splice Site F2 line generated During 2017
sa3015 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3028
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132046 Essential Splice Site None 137 1 2
Genomic Location (Zv9):
Chromosome 19 (position 35822932)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34687452
KASP Assay ID:
554-3381.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAAACGCTGCCAGCGTGAATGCTGRTGCCAGACAATACGAGGAAAGR[T/G]AACTTTGTCCTCATTTACTGTTTCTTTATGATTTGACAAGTCACTGGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3015
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132046 Nonsense 71 137 2 2
Genomic Location (Zv9):
Chromosome 19 (position 35827334)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 34691854
KASP Assay ID:
554-2829.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTMTCCAAACTGTGACGCTGACAGAAGTGTTTTGTGGAAAGAAGAGGTA[T/A]AAATGCTCRGGCTGCCTGCGCTACTATGAGGATCTGGAGTGTCTGATGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link