gad1a

Ensembl ID:
ENSDARG00000093411
ZFIN ID:
ZDB-GENE-070912-472
Description:
Novel protein similar to vertebrate glutamate decarboxylase 1 (Brain, 67kDa) (GAD1) [Source:UniProtK
Human Orthologue:
GAD1
Human Description:
glutamate decarboxylase 1 (brain, 67kDa) [Source:HGNC Symbol;Acc:4092]
Mouse Orthologues:
AC101882.1, Gad1
Mouse Description:
glutamic acid decarboxylase 1 Gene [Source:MGI Symbol;Acc:MGI:95632]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10333 Essential Splice Site Available for shipment Available now
sa21424 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10333
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025332 None None 256 None 7
ENSDART00000109457 Essential Splice Site 210 286 6 7
ENSDART00000140425 Essential Splice Site 186 567 4 14
Genomic Location:
Chromosome 9 (position 3632327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
NNNNAGAGTTAGTGGATCACCYCCTGCTGCGTGTGCATGTGTGTGTTTTC[A/T]GGTTCACGTATGAGATTGCGCCRGTGTTTGTCCTGATGGAGCAGCTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025332 Nonsense 127 256 4 7
ENSDART00000109457 None None 286 None 7
ENSDART00000140425 Nonsense 438 567 11 14
Genomic Location:
Chromosome 9 (position 3623634)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGGACAAGGCCATACAGTGTGGCCGTCATGTAGACATCTTCAAATTCT[G/A]GCTCATGTGGAAGTCAAAGGTGTGTGAGTGCATGTTCAATTTTTTGTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/c5gw0cr2