slc2a11b

Ensembl ID:
ENSDARG00000093395
ZFIN ID:
ZDB-GENE-070705-96
Description:
Novel protein similar to solute carrier family 2, member 1 (Slc2a1) [Source:UniProtKB/TrEMBL;Acc:A5W
Human Orthologues:
AP000350.10, SLC2A11, SLC2A5, SLC2A7, SLC2A9
Human Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 11 [Source:HGNC Symbol;Acc:14239]
solute carrier family 2 (facilitated glucose transporter), member 7 [Source:HGNC Symbol;Acc:13445]
solute carrier family 2 (facilitated glucose transporter), member 9 [Source:HGNC Symbol;Acc:13446]
solute carrier family 2 (facilitated glucose/fructose transporter), member 5 [Source:HGNC Symbol;Acc
Mouse Orthologues:
Slc2a5, Slc2a7, Slc2a9
Mouse Descriptions:
solute carrier family 2 (facilitated glucose transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:
solute carrier family 2 (facilitated glucose transporter), member 7 Gene [Source:MGI Symbol;Acc:MGI:
solute carrier family 2 (facilitated glucose transporter), member 9 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1577 Nonsense Available for shipment Available now
sa13882 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1577
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140570 Nonsense 84 165 3 4
ENSDART00000144486 Nonsense 81 162 3 4

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 5 (position 10927739)
KASP Assay ID:
554-1520.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCTCAGGCTGTGCAGAACTTTATTAATCAGACCTGGACGGAGCGCTA[C/A]AGCACTGAAATCTCCAGTGATATGTTAACCCTCCTCTGGTCCATCATCGT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control; 5 dpf

Control; 5 dpf

zoom

Mutant; 5 dpf

Mutant; 5 dpf

zoom

Control; 5 dpf

Control; 5 dpf

zoom

Mutant; 5 dpf

Mutant; 5 dpf

zoom

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Control on top; Mutant below; 5 dpf

Control on top; Mutant below; 5 dpf

zoom

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
iridophore
ZFA:0009199
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
melanocyte
ZFA:0009091
quality
PATO:0000001
normal
PATO:0000461
Larval:Day 5
ZFS:0000037
xanthophore
ZFA:0009198
absent
PATO:0000462
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
5:10953101-10953779 10953779 1 3.69 × 10-37 -4.0 -6 slc2a11b ENSDARG00000063288
21:14306023-14306400 14306023 -1 4.55 × 10-32 3.1 4 cyb561a3b ENSDARG00000028257
5:10963601-10963944 10963944 1 5.72 × 10-18 -4.5 1 zgc:66350 ENSDARG00000095464
12:26618001-26618916 26618916 1 2.17 × 10-15 -1.8 0 gch2 ENSDARG00000013340
11:31618101-31618426 31618426 1 2.83 × 10-08 -1.0 6 slc22a7a ENSDARG00000056028

Mutation Details

Allele Name:
sa13882
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140570 Nonsense 146 165 4 4
ENSDART00000144486 Nonsense 143 162 4 4

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 5 (position 10928172)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACAAMACCTTTGCTCTGTTGGCTGCTTTGTTCATGGGTTTRAGTTA[T/A]CCTGCAAGCACTTTTGAGCTTTTAGTCATTGGAYGCTTCMTGACAGGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Alzheimer's disease: Genome-wide association study of Alzheimer's disease with psychotic symptoms. (View Study)
  • Biochemical measures: Genome-wide association study of biochemical traits in Korcula Island, Croatia. (View Study)
  • Metabolic traits: Human metabolic individuality in biomedical and pharmaceutical research. (View Study)
  • Renal function-related traits (urea): Meta-analysis identifies multiple loci associated with kidney function-related traits in east Asian populations. (View Study)
  • Urate levels: Association of three genetic loci with uric acid concentration and risk of gout: a genome-wide association study. (View Study)
  • Urate levels: Genome-wide association analyses identify 18 new loci associated with serum urate concentrations. (View Study)
  • Urate levels: Genome-wide association study identifies genes for biomarkers of cardiovascular disease: serum urate and dyslipidemia. (View Study)
  • Urate levels: Multiple genetic loci influence serum urate levels and their relationship with gout and cardiovascular disease risk factors. (View Study)
  • Urate levels: SLC2A9 influences uric acid concentrations with pronounced sex-specific effects. (View Study)
  • Urate levels: SLC2A9 is a newly identified urate transporter influencing serum urate concentration, urate excretion and gout. (View Study)
  • Uric acid levels: A genome wide association study of plasma uric acid levels in obese cases and never-overweight controls. (View Study)
  • Uric acid levels: A genome-wide association study of serum uric acid in African Americans. (View Study)
  • Uric acid levels: Genome-wide association of serum uric acid concentration: replication of sequence variants in an island population of the Adriatic coast of Croatia. (View Study)
  • Uric acid levels: Meta-analysis of 28,141 individuals identifies common variants within five new loci that influence uric acid concentrations. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7c5nxmp4