si:ch73-100n10.1

Ensembl ID:
ENSDARG00000093364
ZFIN ID:
ZDB-GENE-091204-465
Human Orthologue:
MTMR3
Human Description:
myotubularin related protein 3 [Source:HGNC Symbol;Acc:7451]
Mouse Orthologue:
Mtmr3
Mouse Description:
myotubularin related protein 3 Gene [Source:MGI Symbol;Acc:MGI:1921552]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18023 Nonsense Available for shipment Available now
sa18022 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa18023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133446   None 129 None 3
ENSDART00000139023 Nonsense 256 278 5 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4151010)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3894041
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGTTYGATAACTTGCCCAGTGCTTGTGAAGTKGGAAATCCACTAACAT[C/A]AAATCGACGTTCCAGTGACCCAAGTTTGAATGAGAAATGGCAGGACCAKC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18022
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133446 Essential Splice Site 62 129 1 3
ENSDART00000139023   None 278 None 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 4149751)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 3892782
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGGCTGCTGGGATGCTGCGGCTCAWCGGAGACATCRGAGATGAAGTG[G/A]TGAGCAGTCTTTTTGTTTGTTTNNNNATTTATTTTTCGCAACAAGGGACAGTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link