si:ch211-239f4.6

Ensembl ID:
ENSDARG00000093347
ZFIN ID:
ZDB-GENE-061009-18
Description:
Novel protein containing SEA domains [Source:UniProtKB/TrEMBL;Acc:A2AW97]
Human Orthologues:
MUC12, MUC4
Human Descriptions:
mucin 12, cell surface associated [Source:HGNC Symbol;Acc:7510]
mucin 4, cell surface associated [Source:HGNC Symbol;Acc:7514]
Mouse Orthologue:
Muc4
Mouse Description:
mucin 4 Gene [Source:MGI Symbol;Acc:MGI:2153525]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5664 Nonsense F2 line generated During 2017
sa1992 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa5664
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144997 Nonsense 472 558 8 10
ENSDART00000144997 Nonsense 472 558 8 10
Genomic Location (Zv9):
Chromosome 1 (position 45597193)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44440412
KASP Assay ID:
554-3058.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGACTGGGTTTTTCAGCAATTTCAGAGGCTTCTATCAGACAAACGTTT[G/A]GCGGTTCAGGTAAAATTTTATGATGCAATTCTAAAAAGCGGCATCATTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1992
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144997 Nonsense 472 558 8 10
ENSDART00000144997 Nonsense 472 558 8 10
Genomic Location (Zv9):
Chromosome 1 (position 45597193)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44440412
KASP Assay ID:
554-3058.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGACTGGGTTTTTCAGCAATTTCAGAGGCTTCTATCAGACAAACGTTT[G/A]GCGGTTCAGGTAAAATTTTATGATGCAATTCTAAAAAGCGGCATCATTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link