si:ch211-227e10.7

Ensembl ID:
ENSDARG00000093319
ZFIN ID:
ZDB-GENE-050419-53
Description:
hypothetical protein LOC100008037 [Source:RefSeq peptide;Acc:NP_001121772]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25285 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135753 Nonsense 4 96 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 45258260)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 52556551
KASP Assay ID:
554-7503.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGCTCTGCTAATGTCTGCATTGGTGTTTAAGCTGCAGTATGGCAGAG[G/T]AGCGAGTAAAGGATTCTCTCTCAGAGAAACACAGGTATTGACTCTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link