nipbla

Ensembl ID:
ENSDARG00000093281
ZFIN ID:
ZDB-GENE-060526-121
Description:
Novel protein similar to vertebrate Nipped-B homolog (Drosophila) (NIPBL) [Source:UniProtKB/TrEMBL;A
Human Orthologue:
NIPBL
Human Description:
Nipped-B homolog (Drosophila) [Source:HGNC Symbol;Acc:28862]
Mouse Orthologue:
Nipbl
Mouse Description:
Nipped-B homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1913976]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8770 Nonsense Mutation detected in F1 DNA During 2017
sa1954 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa8770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134510 Nonsense 116 1189 3 28
ENSDART00000141735   None 315 None 8

The following transcripts of ENSDARG00000093281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 8306136)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7555024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAGTTAGTATTTGAAATGGATATTTTGATTATTTCAGTTGCAAGACGTT[T/A]AAAGATGAAGCAGAAGAAGAGGAAAGTGTATGAGCCCAAGCKGACTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1954
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134510 Essential Splice Site 971 1189 24 28
ENSDART00000141735   None 315 None 8

The following transcripts of ENSDARG00000093281 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 8330438)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 7531145
KASP Assay ID:
554-1942.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCAAGCATGCTATGACTATGCAGCCCTACCTCACCACCAAGTGCAGT[G/T]TAAGTGCACGCTTCCTCTCTCCATCAGCACATGCYCAACTACCACTGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link