si:dkey-196h17.4

Ensembl ID:
ENSDARG00000093267
ZFIN ID:
ZDB-GENE-081107-57
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JIB8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2702 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2702
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137234   None 537 None 10
ENSDART00000141725   None 121 None 4
ENSDART00000145073 Nonsense 15 498 1 8
ENSDART00000145298   None 224 None 5
ENSDART00000145759   None 159 None 5

The following transcripts of ENSDARG00000093267 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 6716195)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 7185028
KASP Assay ID:
554-3052.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCAACAGGGGAACAGCTCTACAGGGATCACATGRCTGAGAACGAGGAG[A/T]GAGCTATACTCCGTTTACAGCCTCTGCATGTTAGACTATGGACCAGAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link