scn4bb

Ensembl ID:
ENSDARG00000093246
ZFIN ID:
ZDB-GENE-031116-71
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BGB6]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11040 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11040
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125857   None 100 2 2
ENSDART00000141233 Essential Splice Site 74 98 None 2
Genomic Location (Zv9):
Chromosome 5 (position 39534665)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37334055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGAGTTCTRAAATTTTAYCTTCACCGCTGAGCAGATTCTTGATCTTCC[A/G]GRCCTCTGAGACCTGGACAGGCCTTTGACAGGAGGAGTCTTATGCTTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link