si:ch211-146l10.7

Ensembl ID:
ENSDARG00000093216
ZFIN ID:
ZDB-GENE-091112-4

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44095 Nonsense Mutation detected in F1 DNA During 2017
sa14251 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136274 Nonsense 42 850 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9798289)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9857173
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGATTTGTTTGCTTTAATTGCTTGTTTTCCTCTTGTAGTCTATGCCTA[C/A]AGCCCTGGTAGCAGTGGAGTCAATCCTGTATCTAATGATCCTGGTCAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14251
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136274 Nonsense 281 850 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9797574)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9856458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGCCAGGTCACAATGTGCCCATYAGCTYGAAACCTTCCAAAGCCTCA[C/T]AACCTAGCYYATCRATACTACAGTATGGKAGTGTGCCAAGTAGCCAAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link