pcdh1a4

Ensembl ID:
ENSDARG00000093215
ZFIN ID:
ZDB-GENE-050202-4
Description:
protocadherin 1 alpha 4 [Source:RefSeq peptide;Acc:NP_001019270]
Human Orthologues:
PCDHA1, PCDHA10, PCDHA11, PCDHA12, PCDHA13, PCDHA2, PCDHA3, PCDHA4, PCDHA5, PCDHA6, PCDHA7, PCDHA8, PCDHA9
Human Descriptions:
protocadherin alpha 1 [Source:HGNC Symbol;Acc:8663]
protocadherin alpha 10 [Source:HGNC Symbol;Acc:8664]
protocadherin alpha 11 [Source:HGNC Symbol;Acc:8665]
protocadherin alpha 12 [Source:HGNC Symbol;Acc:8666]
protocadherin alpha 13 [Source:HGNC Symbol;Acc:8667]
protocadherin alpha 2 [Source:HGNC Symbol;Acc:8668]
protocadherin alpha 3 [Source:HGNC Symbol;Acc:8669]
protocadherin alpha 4 [Source:HGNC Symbol;Acc:8670]
protocadherin alpha 5 [Source:HGNC Symbol;Acc:8671]
protocadherin alpha 6 [Source:HGNC Symbol;Acc:8672]
protocadherin alpha 7 [Source:HGNC Symbol;Acc:8673]
protocadherin alpha 8 [Source:HGNC Symbol;Acc:8674]
protocadherin alpha 9 [Source:HGNC Symbol;Acc:8675]
Mouse Orthologue:
AC020968.2
Mouse Description:
protocadherin alpha-3 [Source:RefSeq peptide;Acc:NP_619603]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21717 Nonsense Available for shipment Available now
sa21718 Essential Splice Site Available for shipment Available now
sa30651 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21717
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100600 Nonsense 258 789 1 4
Genomic Location (Zv9):
Chromosome 10 (position 21646064)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21607478
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTAAAGTGAAGGAAAACACGCCAGTTGGAACTAAAATAATCTCTGTAT[C/A]AGCCAGAGATTTGGATGAGGGCATTAACAGCGAAATTCAATATTCATTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21718
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100600 Essential Splice Site 789 789 1 4
Genomic Location (Zv9):
Chromosome 10 (position 21647659)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21609073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTGAAGATACTTTTACGCGCACTCAAACTCTTCCTACCAACGAGAAG[G/A]TAAGACGGTAAATTGTTTTGTAATTCATAGCACTGCACTTGACTCAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30651
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100600 Essential Splice Site 789 789 1 4
Genomic Location (Zv9):
Chromosome 10 (position 21647660)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 21609074
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGAAGATACTTTTACGCGCACTCAAACTCTTCCTACCAACGAGAAGG[T/A]AAGACGGTAAATTGTTTTGTAATTCATAGCACTGCACTTGACTCAAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link