ddx1

Ensembl ID:
ENSDARG00000093213
ZFIN ID:
ZDB-GENE-041001-215
Description:
Novel protein similar to vertebrate DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 (DDX1) [Source:UniProtK
Human Orthologue:
DDX1
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 [Source:HGNC Symbol;Acc:2734]
Mouse Orthologue:
Ddx1
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:2144727]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16316 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144780 Essential Splice Site 203 358 None 14

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 33217350)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33275590
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGATGCTACATAGATCTGGAAAAAGGCCATGTGTCATTCTCCAAAAATGG[T/C]AGGGTTCTGWTTAGTTTTAGTAAATAAAACTTTTTCTTTTYAAAATTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link