ftr32

Ensembl ID:
ENSDARG00000093203
ZFIN ID:
ZDB-GENE-070912-108
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S644]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31305 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141384 Nonsense 276 309 5 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 60071325)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59148116
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCAGCAGGAAGGGTTCGGGTAATGAGTGTGGATTTGGACGCAATGAT[C/T]AGTCCTGGAGTTTGGAGTACTCTTCTCACAGTTTCTCATTCTATCATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link