LOC100003785

Ensembl ID:
ENSDARG00000093199
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35870 Nonsense Mutation detected in F1 DNA During 2016
sa4601 Nonsense Mutation detected in F1 DNA During 2016
sa14720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35870
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144991 Nonsense 131 1440 3 35
Genomic Location:
Chromosome 15 (position 19974969)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAAGAGAGAAAAGTCATGTTGAGGCGTTACTATCCTTTGACCTTTATC[C/T]AGACTGATAAACCCATCTATATTCCTGGACAGACGGGTGAGCTGTCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144991 Nonsense 764 1440 19 35
Genomic Location:
Chromosome 15 (position 19966529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTCACAGTTCCTGACACTATCACGACTTGGGAGATGGACGCCTTCTG[T/A]CTGTCCTCCACAGGTCTGGGTTTGGCTCCTCCTGCTCAGCTGACAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144991 Nonsense 1093 1440 27 35
Genomic Location:
Chromosome 15 (position 19957231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCTCTGTCATAGGGTGGAGTGAATGATAAGGTGACCATGACGGCCTA[C/A]ATTACKGCATCACTGCTAGAGCTGGAAACTCCWGTCACAGTAAGTTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link