LOC100003785

Ensembl ID:
ENSDARG00000093199
Human Orthologue:
A2ML1
Human Description:
alpha-2-macroglobulin-like 1 [Source:HGNC Symbol;Acc:23336]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4601 Nonsense Mutation detected in F1 DNA During 2014
sa14720 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4601
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144991 Nonsense 764 1440 19 35
Genomic Location:
Chromosome 15 (position 19966529)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTGTCACAGTTCCTGACACTATCACGACTTGGGAGATGGACGCCTTCTG[T/A]CTGTCCTCCACAGGTCTGGGTTTGGCTCCTCCTGCTCAGCTGACAGTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14720
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144991 Nonsense 1093 1440 27 35
Genomic Location:
Chromosome 15 (position 19957231)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCCTCTGTCATAGGGTGGAGTGAATGATAAGGTGACCATGACGGCCTA[C/A]ATTACKGCATCACTGCTAGAGCTGGAAACTCCWGTCACAGTAAGTTCATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2779xrmi