si:ch211-198m1.1

Ensembl ID:
ENSDARG00000093192
ZFIN ID:
ZDB-GENE-091204-181

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26036 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26036
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140330 Nonsense 20 163 1 3
ENSDART00000143711 Nonsense 20 29 1 3

The following transcripts of ENSDARG00000093192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 18758506)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 18786868
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGGAGTATGATGACGCCATCGTTATTTTAATTACACCTGAAATGGCTT[C/A]ACCCTCTTGTCAGGTAGAAGGTAAGAGCGCCCAATATTGTTTTGAAATAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link