PKHD1L1 (1 of 3)

Ensembl ID:
ENSDARG00000093191
Description:
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 [Source:HGNC Symbol;Acc:20313]
Human Orthologue:
PKHD1L1
Human Description:
polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1 [Source:HGNC Symbol;Acc:20313]
Mouse Orthologue:
Pkhd1l1
Mouse Description:
polycystic kidney and hepatic disease 1-like 1 Gene [Source:MGI Symbol;Acc:MGI:2183153]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29197 Essential Splice Site Mutation detected in F1 DNA During 2017
sa18556 Essential Splice Site Available for shipment Available now
sa987 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Essential Splice Site 482 1019 None 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23346766)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23276181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTACAGCACCCAGAGGTCCGCTGTCATGCGCTTAGAGAAGGGAAAACCG[T/G]AAGTTTTAAATGGTGCTTAAATGTGTGATGTGTGTCCAATTGGTGTGTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18556
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Essential Splice Site 535 1019 None 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23348269)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23277684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGAAACAGCAGATCAACGCATACTACTCTATACTACCTGAAAAAYAGG[T/C]AAGTGAACTCACTTTAGGCAGAGTTCAAAGATTATCTAAAGATAAGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135830 Nonsense 709 1019 19 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 23349482)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23278897
KASP Assay ID:
554-0891.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTCCAGCAGAGATTCCAACCGCTGAGAACAGTAACGTGAAATTTTTC[A/T]GAGATTATGAGATGACCACCACAGGGGTAAGCTGCAAATGCACATGATCA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link