or125-7

Ensembl ID:
ENSDARG00000093183
ZFIN ID:
ZDB-GENE-070806-97
Description:
odorant receptor, family E, subfamily 125, member 7 [Source:RefSeq peptide;Acc:NP_001121886]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1087 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1087
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136171 Nonsense 268 311 1 1
Genomic Location (Zv9):
Chromosome 21 (position 20551240)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 21627410
KASP Assay ID:
554-0989.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATACCTTGTGTAATAGATTTGGATCAGATGATGTCCCWGTGAACCTC[A/T]GATTTTTTTTAGCTTTAGAGATGATTGTAGTGCCACCTCTTGTAAATCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link