LOC568645

Ensembl ID:
ENSDARG00000093161
Human Orthologue:
GALNT8
Human Description:
UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8) [Sour

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30228 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa30228
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136368 Nonsense 253 561 5 12
Genomic Location (Zv9):
Chromosome 25 (position 17118443)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 16664987
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACACACTGGAGGTTACTAAGTATAGTCCTGCTGCTCATGCGTTTAATTG[G/A]AACCTTTGGTGCATGTACGAATCCTTCCGACCAGAATGGTACAAACTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link