si:ch211-57f7.7

Ensembl ID:
ENSDARG00000093131
ZFIN ID:
ZDB-GENE-090313-119
Description:
Novel ubiquitin-protein ligase protein [Source:UniProtKB/TrEMBL;Acc:B8A5Z8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35445 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa35445
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135186 Nonsense 4 271 1 4
Genomic Location (Zv9):
Chromosome 13 (position 15811956)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15726989
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACGCTGTTGTATTGACACTTCTTCTTTAATTTTATGTCAGCCATGAGG[G/T]AGGACAGATATTTCATTGCAGGGAGAGCAGTTGCAGTCAGTCTTGTGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link