si:ch73-112l6.1

Ensembl ID:
ENSDARG00000093126
ZFIN ID:
ZDB-GENE-091204-14

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43637 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43637
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138128 Nonsense 134 1025 3 10
Genomic Location (Zv9):
Chromosome 21 (position 21348648)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 22360141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGCGGACTGCACAACACCGTCAGAAAGGTTTTGGACATCAGCGGCTG[G/A]TATTTCATGGTCACAGAGTATTTGGAGTGCTGTTCCTGTAGGAAGAAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link