si:ch1073-55a19.2

Ensembl ID:
ENSDARG00000093125
ZFIN ID:
ZDB-GENE-081104-93
Description:
Novel protein similar to H.sapiens RANBP2-like and GRIP domain containing [Source:UniProtKB/TrEMBL;A
Human Orthologues:
RANBP2, RGPD1, RGPD2, RGPD3, RGPD4, RGPD5, RGPD6, RGPD8
Human Descriptions:
RAN binding protein 2 [Source:HGNC Symbol;Acc:9848]
RANBP2-like and GRIP domain containing 1 [Source:HGNC Symbol;Acc:32414]
RANBP2-like and GRIP domain containing 2 [Source:HGNC Symbol;Acc:32415]
RANBP2-like and GRIP domain containing 3 [Source:HGNC Symbol;Acc:32416]
RANBP2-like and GRIP domain containing 4 [Source:HGNC Symbol;Acc:32417]
RANBP2-like and GRIP domain containing 5 [Source:HGNC Symbol;Acc:32418]
RANBP2-like and GRIP domain containing 6 [Source:HGNC Symbol;Acc:32419]
RANBP2-like and GRIP domain containing 8 [Source:HGNC Symbol;Acc:9849]
Mouse Orthologue:
Ranbp2
Mouse Description:
RAN binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:894323]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9097 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135682   None 604 None 10
ENSDART00000137939   None 202 None 2
ENSDART00000140596   None 153 None 5
ENSDART00000140961 Nonsense 230 481 4 4
ENSDART00000145968   None 199 None 4
Genomic Location (Zv9):
Chromosome 9 (position 412016)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 104348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTTTGGGGGCGTCATTGTGGCTCCATCAACATCSACCACTACAACCT[C/A]GACTGCGTTCAAGTTCAACTCCAATTTCAAGTCCAATGATGGCGACTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link