scpp8

Ensembl ID:
ENSDARG00000093124
ZFIN ID:
ZDB-GENE-090424-2
Description:
secretory calcium-binding phosphoprotein 8 [Source:RefSeq peptide;Acc:NP_001138716]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9073 Nonsense Mutation detected in F1 DNA During 2017
sa18980 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141588 Nonsense 70 188 3 5
ENSDART00000141588 Nonsense 70 188 3 5
Genomic Location (Zv9):
Chromosome 10 (position 15136590)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15149897
KASP Assay ID:
2260-3005.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTAAATATATACAGACTGSGACTGTTCTATCACTGGACAAGAMCATTWA[T/A]ACAAGGTAACTCACTCRTATCTTGAGTTATGATGCATTTATGGCTTTTTR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18980
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141588 Nonsense 70 188 3 5
ENSDART00000141588 Nonsense 70 188 3 5
Genomic Location (Zv9):
Chromosome 10 (position 15136590)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 15149897
KASP Assay ID:
2260-3005.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTAAATATATACAGACTGGGACTGTTCTATCACTGGACAAGAACATTTA[T/A]ACAAGGTAACTCACTCGTATCTTGAGTTATGATGCATTTATGGCTTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link