si:ch1073-188c16.3

Ensembl ID:
ENSDARG00000093079
ZFIN ID:
ZDB-GENE-081103-54
Description:
Novel coagulation factor [Source:UniProtKB/TrEMBL;Acc:B8JLG2]
Human Orthologue:
PROC
Human Description:
protein C (inactivator of coagulation factors Va and VIIIa) [Source:HGNC Symbol;Acc:9451]
Mouse Orthologue:
Proc
Mouse Description:
protein C Gene [Source:MGI Symbol;Acc:MGI:97771]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43 Nonsense Confirmed mutation in F2 line During 2017
hu3567 Essential Splice Site Confirmed mutation in F2 line Unknown

Mutation Details

Allele Name:
sa43
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132496 Nonsense 65 427 4 10

The following transcripts of ENSDARG00000093079 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5117286)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5551879
GRCz10 2 5563014
KASP Assay ID:
554-0136.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCGGCATCGCTGGAGCGGGAGTGCAGAGAGGAACTGTGCGATTTCGAA[G/T]AAGCAAGAGAAATCTTTATAACAAGGGAGGCCACGGTTGGTCAGCTTTTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
hu3567
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132496 Essential Splice Site 84 427 5 10

The following transcripts of ENSDARG00000093079 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 5117149)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5562877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTACTGAGTTCTTCATCCTGCAGCTGGAATTCTGGACGGCATATAAAG[G/A]TTAGTTCAGTCTGTGCTGTGGTGTAGCTTTGCAAGTGCGTCATAACTCAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Protein C levels: Genome-wide association study identifies novel loci for plasma levels of protein C: the ARIC study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link