si:dkey-21e7.2

Ensembl ID:
ENSDARG00000093068
ZFIN ID:
ZDB-GENE-030131-2211
Description:
hypothetical protein LOC563665 [Source:RefSeq peptide;Acc:NP_001093483]
Human Orthologue:
C3
Human Description:
complement component 3 [Source:HGNC Symbol;Acc:1318]
Mouse Orthologue:
C3
Mouse Description:
complement component 3 Gene [Source:MGI Symbol;Acc:MGI:88227]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30732 Nonsense Mutation detected in F1 DNA During 2017
sa43860 Nonsense Mutation detected in F1 DNA During 2017
sa31073 Nonsense Mutation detected in F1 DNA During 2017
sa24189 Nonsense Available for shipment Available now
sa37529 Nonsense Mutation detected in F1 DNA During 2017
sa37528 Nonsense Mutation detected in F1 DNA During 2017
sa32404 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138595 Nonsense 7 1680 1 42

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827416)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216272
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATATTGAGTGGCGGTTACTTCAGCAGGACGATGCTTCTTCAGCTGCTGT[T/A]ATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138595 Nonsense 24 1680 1 42
ENSDART00000138595 Nonsense 24 1680 1 42

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827366)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAA[C/T]GACAGTGCGTTTAACTCTGCATTATTAACTTTTAATGTGTAAAAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138595 Nonsense 24 1680 1 42
ENSDART00000138595 Nonsense 24 1680 1 42

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 26827366)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26216222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGGCGACCCTGCTCTGTCAAATCTGCGATGGAAAGGCCTTCCCTCAA[C/T]GACAGTGCGTTTAACTCTGCATTATTAACTTTTAATGTGTAAAAATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24189
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138595 Nonsense 158 1680 5 42
Genomic Location (Zv9):
Chromosome 22 (position 26821515)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26210371
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCGTTCCGCTCCGGACACATCTTCATTCAGACCGACAAACCTATTTA[C/A]AACCCTGGAGACAAAGGTCAGCTCTCACATGCTGCTATTGAGCTGTTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37529
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138595 Nonsense 1224 1680 29 42
Genomic Location (Zv9):
Chromosome 22 (position 26788528)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26177384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATGCTATGCGCTAGCCGTATCGAACAACGCCTGCGTGAAGAGCATGT[T/A]GCTCAAATTTGCCTCACCTGGTACTTACATTTTAAACGCACAAATATGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138595 Nonsense 1270 1680 30 42
Genomic Location (Zv9):
Chromosome 22 (position 26788309)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26177165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCTGATCAAAAGTGGCCACATGGAAGAGGCAGAAGCTCCATTTCGATG[G/A]TTGAATGAGCACCGTGGCATTGGTGGAGGATACGGCTCTACTCAGGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138595 Nonsense 1364 1680 33 42
Genomic Location (Zv9):
Chromosome 22 (position 26779319)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 26168175
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTAGATGTAATTCATCGTTTATGTGTAATAGGTAGTGACGGTTTACCAT[C/T]AGCTTCCTGATGTGTATGAGAACAGCACATGCAACGGCTTTCAGCTGGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link