si:ch211-207i1.1

Ensembl ID:
ENSDARG00000093063
ZFIN ID:
ZDB-GENE-041014-148
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5RHJ6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa752 Nonsense Available for shipment Available now
sa12747 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140446 Nonsense 26 296 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21838470)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21866637
KASP Assay ID:
554-0659.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCACAGAGGCCCAAGAGGTCTGCCAGCACCTAAGCAGCAGGCAGCGT[C/T]GRGGCCACTTGGAGCCACATCTTAGGGCTAAAGTGAGTAGAAATTGGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140446 Nonsense 195 296 3 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21837793)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21865960
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCATGATAAATCTCCCGAAGATCAAAGGAAAGCTAAATGCCAAATACAG[C/T]AAGCAGACCTCAAACAGCCTTTGTTGTCATCCGTTGTTGGCAGGAAGGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link