ENSDARG00000093059

Ensembl ID:
ENSDARG00000093059
Human Orthologues:
LGALS7, LGALS7B
Human Descriptions:
lectin, galactoside-binding, soluble, 7 [Source:HGNC Symbol;Acc:6568]
lectin, galactoside-binding, soluble, 7B [Source:HGNC Symbol;Acc:34447]
Mouse Orthologue:
Lgals7
Mouse Description:
lectin, galactose binding, soluble 7 Gene [Source:MGI Symbol;Acc:MGI:1316742]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5791 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa5791
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132493 Essential Splice Site 180 230 5 6
ENSDART00000132493 Essential Splice Site 180 230 5 6
Genomic Location:
Chromosome 15 (position 30285811)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGCAAAGACATTGTTATTCATGGAGTTCCTAATGCTGACTCAAAAAG[G/T]TGAGATGAAATATATTCTTTCTAKAATGTGGATGTTAAAAGTTATTTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/52mznzc0