c6

Ensembl ID:
ENSDARG00000093052
ZFIN ID:
ZDB-GENE-040426-1358
Human Orthologue:
C6
Human Description:
complement component 6 [Source:HGNC Symbol;Acc:1339]
Mouse Orthologue:
C6
Mouse Description:
complement component 6 Gene [Source:MGI Symbol;Acc:MGI:88233]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23911 Essential Splice Site Mutation detected in F1 DNA During 2014
sa23910 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138553 Essential Splice Site 29 710 1 14
ENSDART00000139430 Essential Splice Site 49 855 2 18
ENSDART00000144861 Essential Splice Site 49 243 2 6
Genomic Location:
Chromosome 21 (position 19660211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCCCAATGCACTAAAACCTGTGATTCTGGTACTCAATCACGTTTAAG[G/A]TAACAATTATTGAGCATTTATCTGATGTGTAAAGCTTAATGTTGTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138553 None None 710 None 14
ENSDART00000139430 Essential Splice Site 839 855 18 18
ENSDART00000144861 None None 243 None 6
Genomic Location:
Chromosome 21 (position 19623703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTATATTCAACTAAAATAATTCAACAGTCTTATTGTCTTTTCTTCTTA[G/A]TGTCCAAAACGTGTGAGTGTAAGATGCCCAGAGAATGTCCAAAAGACGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/me4ld19u