c6

Ensembl ID:
ENSDARG00000093052
ZFIN ID:
ZDB-GENE-040426-1358
Human Orthologue:
C6
Human Description:
complement component 6 [Source:HGNC Symbol;Acc:1339]
Mouse Orthologue:
C6
Mouse Description:
complement component 6 Gene [Source:MGI Symbol;Acc:MGI:88233]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23911 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37283 Nonsense Mutation detected in F1 DNA During 2016
sa23910 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa23911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138553 Essential Splice Site 29 710 1 14
ENSDART00000139430 Essential Splice Site 49 855 2 18
ENSDART00000144861 Essential Splice Site 49 243 2 6
Genomic Location (Zv9):
Chromosome 21 (position 19660211)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20795700
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTCCCAATGCACTAAAACCTGTGATTCTGGTACTCAATCACGTTTAAG[G/A]TAACAATTATTGAGCATTTATCTGATGTGTAAAGCTTAATGTTGTGATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37283
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138553 Nonsense 222 710 5 14
ENSDART00000139430 Nonsense 240 855 6 18
ENSDART00000144861 Nonsense 240 243 6 6
Genomic Location (Zv9):
Chromosome 21 (position 19652150)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20787639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAACTAAAGAGGAACCTCTACAGAATCTCAGCCAACACTGAGAGATA[T/A]GAACTCAAGGTCAGAAAGAAATCATTTTATGCAAGTATTTGAGTTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138553   None 710 None 14
ENSDART00000139430 Essential Splice Site 839 855 18 18
ENSDART00000144861   None 243 None 6
Genomic Location (Zv9):
Chromosome 21 (position 19623703)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 20759192
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTATATTCAACTAAAATAATTCAACAGTCTTATTGTCTTTTCTTCTTA[G/A]TGTCCAAAACGTGTGAGTGTAAGATGCCCAGAGAATGTCCAAAAGACGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link