si:ch211-161h7.5

Ensembl ID:
ENSDARG00000093044
ZFIN ID:
ZDB-GENE-091204-265

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44124 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8571 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44124
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133763 Essential Splice Site 248 345 7 8
Genomic Location (Zv9):
Chromosome 24 (position 21519963)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20767092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTTAATTGTTGAAAATAATTCTAATTTAATAGTTCCTCTAATTTTAC[A/T]GGTTCATTGTGGAGACTTTTGTGTTTGAGAAGCACCTACGATACATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133763 Nonsense 340 345 8 8
Genomic Location (Zv9):
Chromosome 24 (position 21518800)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 20765929
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACAKGAATGCAGATGAAGCTGTGTTACCGATGGAGACCTCTGAAAAA[C/T]AAAAGACGATTCAATTCTAAATTTATAATCATCCAAAAATATGTTTTTWT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link