si:ch211-89o5.1

Ensembl ID:
ENSDARG00000092997
ZFIN ID:
ZDB-GENE-091116-8

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41705 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41705
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137006 Essential Splice Site 21 140 None 5

The following transcripts of ENSDARG00000092997 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 36765429)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 29207873
GRCz10 23 18986626
GRCz10 2 32718705
GRCz10 7 26263041
GRCz10 KN150680.1 12465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATAGAAGCAGGACGCCACAGCCGGATTTCTGTACATCCATTTGCACAG[T/A]AAGTCACATTTTATATTGTACCAGACTGTTTATTAAAGAAAAACTTTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link