si:ch211-231h23.2

Ensembl ID:
ENSDARG00000092989
ZFIN ID:
ZDB-GENE-041210-102
Description:
Novel protein similar to H.sapiens TMTC2, transmembrane and tetratricopeptide repeat containing 2 (T
Human Orthologues:
AC008735.1, CD5L
Human Descriptions:
CD5 molecule-like [Source:HGNC Symbol;Acc:1690]
Scavenger receptor cysteine-rich domain-containing protein LOC284297 [Source:UniProtKB/Swiss-Prot;Ac
Mouse Orthologues:
A430110N23Rik, Cd5l
Mouse Descriptions:
CD5 antigen-like Gene [Source:MGI Symbol;Acc:MGI:1334419]
RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31382 Nonsense Available for shipment Available now
sa31381 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31382
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136440 Nonsense 80 1241 1 12
Genomic Location (Zv9):
Chromosome 4 (position 10036075)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10972702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACACAAGAGATTCACTGCACAGGAAATGAGTCTCAGATTCACCTCTG[T/A]CCAACATCACCTTCACAGGAAAATAACAGTTCTCATTACAGTGTTGGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136440 Nonsense 642 1241 7 12
Genomic Location (Zv9):
Chromosome 4 (position 10030194)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 10966821
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGATCTCACCTGTGCTCTGGGAGGTTAGAGGTGGCTCATGGGAACACTTG[G/A]ATGTCAGTGTGTGATGCTGCCTTTGACCAGCAGGATGCAGAGGTTGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link