si:ch211-244o18.1

Ensembl ID:
ENSDARG00000092971
ZFIN ID:
ZDB-GENE-091118-99
Human Orthologue:
MLL3
Human Description:
myeloid/lymphoid or mixed-lineage leukemia 3 [Source:HGNC Symbol;Acc:13726]
Mouse Orthologue:
Mll3
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3276 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3276
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133525 Nonsense 372 589 8 14
Genomic Location (Zv9):
Chromosome 24 (position 7612204)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7469496
KASP Assay ID:
554-3305.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGATATAGGAAGAAAAAAACCAAACTCGAGGAGGCGTTCCCTTCGTA[T/A]CTACAGGTCAGTGTTTCTTAAACTGTAGACTTTAGGGCCAAWCATGCTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link