ENSDARG00000092969

Ensembl ID:
ENSDARG00000092969

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24755 Nonsense Available for shipment Available now
sa24756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24755
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132403 Nonsense 76 443 2 2
Genomic Location:
Chromosome Zv9_scaffold3536 (position 307212)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGACTAAAAAGACTTCACGTGGAAGACCTCAGAAACCCAAATCTGGATG[T/A]CTTTTAAGCTGTAAACAGTGTGGAAAGAGATACAGTCAAAAGTCACACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132403 Nonsense 78 443 2 2
Genomic Location:
Chromosome Zv9_scaffold3536 (position 307217)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAAAGACTTCACGTGGAAGACCTCAGAAACCCAAATCTGGATGTCTTT[T/A]AAGCTGTAAACAGTGTGGAAAGAGATACAGTCAAAAGTCACACCTTGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sztasgp0