notch2

Ensembl ID:
ENSDARG00000092960
ZFIN ID:
ZDB-GENE-000329-4
Description:
notch homolog 2 [Source:RefSeq peptide;Acc:NP_001108566]
Human Orthologues:
NOTCH2, NOTCH2NL, RP11-458D21.5
Human Descriptions:
notch 2 N-terminal like [Source:HGNC Symbol;Acc:31862]
notch 2 [Source:HGNC Symbol;Acc:7882]
Mouse Orthologue:
Notch2
Mouse Description:
Notch gene homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:97364]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31643 Nonsense Available for shipment Available now
sa34370 Nonsense Mutation detected in F1 DNA During 2017
sa7129 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25391 Nonsense Mutation detected in F1 DNA During 2017
sa41176 Essential Splice Site Mutation detected in F1 DNA During 2017
sa34371 Nonsense Mutation detected in F1 DNA During 2017
sa41177 Essential Splice Site Mutation detected in F1 DNA During 2017
sa38684 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31643
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 516 2475 9 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20131434)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19561331
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCAGCTCACCTTGTCTTAATAACGGTAGATGTCTAGACCAGGTCAGC[C/T]GATTCGTCTGCGAGTGTCCTCAGGGTCAGTATAATGATTGGTGCAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 667 2475 12 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20134590)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19564487
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAGTAATCCCTGCCAGCACGGGACCTGTGAGGATGGAATCAATGAGTA[C/A]AAATGCGTGTGCGAACCTGGATACACAGGTTTGTTCATCCCACATGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Essential Splice Site 790 2475 None 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20137043)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19566940
KASP Assay ID:
554-4892.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGACCGTCTGAATGATTAYACCTGCKTATGCGCCCGTGGGTTTGCAGG[T/G]AATGGCATGTGATCCTTTCTAAACAAAGTAACAAAGACATTTAGKTCATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25391
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 800 2475 15 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20137160)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19567057
KASP Assay ID:
554-7785.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCCTTTCTTTCATTCAGGTTTCAACTGTGAGATCAACATAAATGAATG[T/A]GAGTCAAACCCCTGCATGAATCAGGGAACCTGTGTGGATGGAGTCAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41176
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Essential Splice Site 868 2475 None 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20138965)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19568862
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTGGATTACACCAGCTACACCTGCAAATGCCACAGCGGCTGGGAGGG[T/C]GAGCGCTTCAAGTCTGGGTGTTGGTGTGATTACATATTTAAGTCAGTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34371
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Nonsense 909 2475 17 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20139336)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19569233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGGCAGCTACCGTTGCGAATGCCCGCCTGGATACAGCGGGGACAACTG[C/A]CAGACCAACATCGATGACTGCAGCTCTAGTACGTGTCTTTCCCACACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41177
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Essential Splice Site 1114 2475 None 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20140982)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19570879
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATTGTGACATCCCCAGCATGTCCTGCCACGCTGTTGCCCTCAACAAAGG[T/A]AATACATTAGACATCTTCAGTGTAATTCCTTTGGAAGATATTTTATGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123104 Splice Site, Nonsense 1508 2475 25 34

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 20146644)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19576541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCCTATTCGACAGCTTTGAATGCGACAAACATTCATCGGTGGGAATTTG[C/A]AAGTATGTTTACCAGTGTATTTTAATACTTTAGCACCTCACTTCTCTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 2 diabetes: Meta-analysis of genome-wide association data and large-scale replication identifies additional susceptibility loci for type 2 diabetes. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link