cyt1

Ensembl ID:
ENSDARG00000092947
ZFIN ID:
ZDB-GENE-991008-6
Description:
type I cytokeratin, enveloping layer [Source:RefSeq peptide;Acc:NP_571182]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29143 Nonsense Mutation detected in F1 DNA During 2016
sa16968 Nonsense Available for shipment Available now
sa36767 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa29143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004812 Nonsense 272 429 4 7
ENSDART00000105034 Nonsense 187 344 5 8
ENSDART00000105806 Nonsense 267 424 5 8
ENSDART00000139704 Nonsense 60 217 2 5
ENSDART00000145574 Nonsense 210 367 5 8

The following transcripts of ENSDARG00000092947 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5987607)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5446918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCACTACGAGGCAGTTTCTGCCAAGAACCGTAAAGATCTTGAGAGTTG[G/A]TTCCAGGCCAAGGTAAAAATCTGTTTTAACATGTCAAATTTGTTTAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004812 Nonsense 276 429 4 7
ENSDART00000105034 Nonsense 191 344 5 8
ENSDART00000105806 Nonsense 271 424 5 8
ENSDART00000139704 Nonsense 64 217 2 5
ENSDART00000145574 Nonsense 214 367 5 8

The following transcripts of ENSDARG00000092947 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5987597)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5446908
KASP Assay ID:
2261-2858.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCAGTTTCTGCCAAGAACCGTAAAGWTCTTGAGAGTTGGTTCCAGGCC[A/T]AGGTAAAAATCTGWTTTAACATGTCAAATTTGTTTAGCAAGATGGAAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004812 Nonsense 402 429 7 7
ENSDART00000105034 Nonsense 317 344 8 8
ENSDART00000105806 Nonsense 397 424 8 8
ENSDART00000139704 Nonsense 190 217 5 5
ENSDART00000145574 Nonsense 340 367 8 8

The following transcripts of ENSDARG00000092947 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 5986922)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 5446233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCATATTTCTATTTCTCCAGTGTTTCCACAAGCTCAAGCACTACACGC[A/T]AAGTGGTAACCATTGTGGAAGAGGTGGTGGATGGAAAAGTGGTCAGCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link