cyt1

Ensembl ID:
ENSDARG00000092947
ZFIN ID:
ZDB-GENE-991008-6
Description:
type I cytokeratin, enveloping layer [Source:RefSeq peptide;Acc:NP_571182]
Human Orthologues:
KRT14, KRT16, KRT20, KRT23
Human Descriptions:
keratin 14 [Source:HGNC Symbol;Acc:6416]
keratin 16 [Source:HGNC Symbol;Acc:6423]
keratin 20 [Source:HGNC Symbol;Acc:20412]
keratin 23 (histone deacetylase inducible) [Source:HGNC Symbol;Acc:6438]
Mouse Orthologues:
Krt14, Krt16, Krt20, Krt23
Mouse Descriptions:
keratin 14 Gene [Source:MGI Symbol;Acc:MGI:96688]
keratin 16 Gene [Source:MGI Symbol;Acc:MGI:96690]
keratin 20 Gene [Source:MGI Symbol;Acc:MGI:1914059]
keratin 23 Gene [Source:MGI Symbol;Acc:MGI:2148866]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16968 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16968
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004812 Nonsense 276 429 4 7
ENSDART00000105034 Nonsense 191 344 5 8
ENSDART00000105806 Nonsense 271 424 5 8
ENSDART00000139704 Nonsense 64 217 2 5
ENSDART00000145574 Nonsense 214 367 5 8

The following transcripts of ENSDARG00000092947 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 19 (position 5987597)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGCAGTTTCTGCCAAGAACCGTAAAGWTCTTGAGAGTTGGTTCCAGGCC[A/T]AGGTAAAAATCTGWTTTAACATGTCAAATTTGTTTAGCAAGATGGAAATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification of 15 loci influencing height in a Korean population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6q9s6orh