si:ch211-201p7.4

Ensembl ID:
ENSDARG00000092936
ZFIN ID:
ZDB-GENE-090312-128
Human Orthologue:
CACNA1H
Human Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit [Source:HGNC Symbol;Acc:1395]
Mouse Orthologue:
Cacna1h
Mouse Description:
calcium channel, voltage-dependent, T type, alpha 1H subunit Gene [Source:MGI Symbol;Acc:MGI:1928842

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15566 Nonsense Available for shipment Available now
sa32587 Splice Site Mutation detected in F1 DNA During 2017
sa18685 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132539   None 717 None 17
ENSDART00000133407   None 204 None 4
ENSDART00000137417 Nonsense 117 208 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 7410208)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7650013
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGGATGGGCGGATATCATGTATTATGTCATGGATGCTCATTCCTTTTA[C/A]AACTTCATCTATTTCATCTTCCTTATCATCGTAAGTGCACARTAATTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32587
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132539 Splice Site None 717 None 17
ENSDART00000133407   None 204 None 4
ENSDART00000137417   None 208 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 7452137)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7691942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGATACTGTTGCAACACTGAATATGTGTGTGTGTGTATGTGTGTGTCTTA[T/A]CAGGGTCATAAGCAGAGCTCCTGGACTGAAGCTGGTTGTTGAAACATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132539 Essential Splice Site 233 717 6 17
ENSDART00000133407   None 204 None 4
ENSDART00000137417   None 208 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 7452533)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7692338
KASP Assay ID:
2259-0152.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAATACAAATGGATCCGTCGGAAGTACAACTTTGATAACCTGGGTCAG[G/A]TAGGACACACTCACAAAAACACACACACATACACATAGACTTTAACAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132539 Nonsense 520 717 14 17
ENSDART00000133407   None 204 None 4
ENSDART00000137417   None 208 None 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 7472160)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7711965
KASP Assay ID:
554-1615.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCATTAACTTTGATTCAGATTGCACTGAGGAGAACCCCTGTGAGGGTT[T/A]GAGCAGACATGCCACATTTCAGAACTTCGGCATGGCTTTCCTTACTCTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link