prdm10

Ensembl ID:
ENSDARG00000092932
ZFIN ID:
ZDB-GENE-050419-74
Description:
PR domain zinc finger protein 10 [Source:UniProtKB/Swiss-Prot;Acc:A2BID7]
Human Orthologue:
PRDM10
Human Description:
PR domain containing 10 [Source:HGNC Symbol;Acc:13995]
Mouse Orthologue:
Prdm10
Mouse Description:
PR domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:2682952]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36721 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36721
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145714 Nonsense 80 897 2 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 42767900)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 44357791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCCCACCCTGACGGAGGCCTCGTCAAGTCCCCTCGGGGCCACAGATT[C/A]AACTGTAGACTCTGAGGACGAGGAAGAAGACAATGATAGCGAGGATTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link