si:ch211-132b12.4

Ensembl ID:
ENSDARG00000092930
ZFIN ID:
ZDB-GENE-050419-207
Description:
Transporter [Source:UniProtKB/TrEMBL;Acc:Q1LVI8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8547 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000146262 Nonsense 2 112 1 3
Genomic Location (Zv9):
Chromosome 18 (position 38906341)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 40619058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTCAGAGGAAGCAAAGCAGAGTTTCTTCTGGCTGTGGCAGGAAATGTG[G/A]TTGGASTGGGYAACGTGTGGAGGTTTTCCTTACCTCTRCTACAGGAATGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link