si:ch211-146l10.5

Ensembl ID:
ENSDARG00000092924
ZFIN IDs:
ZDB-GENE-080215-16, ZDB-GENE-091112-14
Description:
hypothetical protein LOC100137113 [Source:RefSeq peptide;Acc:NP_001108182]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31099 Nonsense Mutation detected in F1 DNA During 2017
sa24450 Nonsense Available for shipment Available now
sa1427 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124341 Nonsense 118 847 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9814646)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9873530
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACTCCCATGATAAGTGAAAAACAAGGCTCTGAATCGCATACAAGCCAA[C/T]AAGGATTTCATGTTGATTCAGTTGGAACTGGTAGTCTTGTTTATGGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24450
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124341 Nonsense 498 847 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9813504)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9872388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGTCTGGGCCCTGGTTTGTTGTTCAACAACCAGCACAAATAGTCTA[C/A]CAGTCTGCTAGCCAGCCCACTGTGCCACACCTAGTAGAAACCATCTACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124341 Nonsense 531 847 3 3
Genomic Location (Zv9):
Chromosome 24 (position 9813407)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 9872291
KASP Assay ID:
554-1348.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCAGTCTGCTTCCCAACAACCAGCACAAGCTAGCTACCAKTTGGTGGAA[C/T]AGCCAGCACAGGTCAGCTCATCTGTAGGCCATCTTCAAGCTGGACAGTCC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link