gnb5a

Ensembl ID:
ENSDARG00000092921
ZFIN ID:
ZDB-GENE-070112-342
Description:
guanine nucleotide binding protein (G protein), beta 5a [Source:RefSeq peptide;Acc:NP_001073650]
Human Orthologue:
GNB5
Human Description:
guanine nucleotide binding protein (G protein), beta 5 [Source:HGNC Symbol;Acc:4401]
Mouse Orthologue:
Gnb5
Mouse Description:
guanine nucleotide binding protein (G protein), beta 5 Gene [Source:MGI Symbol;Acc:MGI:101848]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25222 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25222
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027720 Nonsense 279 355 9 11

The following transcripts of ENSDARG00000092921 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 4861093)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 4722335
KASP Assay ID:
554-7882.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTAGTGTCGTCTGTATGACCTGAGGGCGGACAGAGAGGTGGCCATTTA[T/A]TCCAAAGAGAGCATCATATTCGGGGCTTCTAGTGTGGATTTCTCCCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link